.png)
Molecular Cloning - Part II (Primer Designing)
Designing a primer
To understand how to design a cloning primer, let us consider the following set of primers –
Forward Primer with restriction site for BamHI and a TEV cleavage site –
5’GTCGGATCCGAGAACCTGTACTTTCAGGGTCAAGAAGGCGATGAAGAG3’
Reverse Primer with EcoRI site –
5’GTCGAATTCTTACACTTGAATGCCAGTTCC3’
Forward primer –
1. Flanking residues – In general, 6 base pairs 5’ to the restriction site helps in efficient cleavage and prevent the formation of primer dimers. However, these extra bases need not be specific but random. To check the number of extra bases (as it is specific to the restriction enzyme), click on the link.
GTC marked in red are the three flanking residues.
2. Restriction site – As per the restriction enzyme selected (check vector selection), add the specific sequence.
GGATCC marked in blue here, is the restriction site for BamHI.
3. Cleavage site – Some vectors can have tags that are large or need to be removed to prevent their influence on the data. Therefore, a cleavage site is introduced specifically to a protease. An example of protease is TEV which recognizes the sequence ENLYFQXS.
The sequence highlighted in green is of the TEV protease.
4. Nucleotide sequence – Use sequence massager (link below) to remove any numbers, markups, comments, etc., from the FASTA sequence. Ideally, 15-20 nucleotides are recommended to be taken from the start of the sequence. However, it’s essential that the sequence ends in a G or C because G-C is formed by triple hydrogen bonds, thus providing higher primer stability.
https://biomodel.uah.es/en/lab/cybertory/analysis/massager.htm
Reverse primer –
Everything remains the same for reverse primer except –
1. Restriction site – It is recommended to use a different restriction site than used for the forward primer to prevent a change in the orientation of the gene of interest. Therefore, the restriction site in the reverse primer will be different.
2. No Cleavage site is required.
3. Stop codon – A stop codon is to be added before the nucleotide sequence. Use sequence massager to obtain the reverse complementary (antiparallel complementarity) of the stop codon.
The sequence highlighted in orange is the reverse complementary sequence of the stop codon.
4. Nucleotide sequence – Remember, for reverse primers, a reverse complementary sequence of the FASTA is required. 15-20 nucleotides from the last should be used, which end with G or C.
Check further parameters, such as
GC content – GC content should be between 40-60%. Lower GC content can make the primers unstable, whereas higher can allow tertiary or quaternary structure formation.
Length – A shorter primer is more prone to non-specific inaccurate binding, whereas a longer primer induces the hairpin formation and slow hybridization. The ideal length of primers can vary between 18-24 bases.
Temperature – Ideal melting temperature (Tm) of primers should be between 65-75°C, with the temperature difference between both the primers less than 5°C.
No repetitive or complementary bases
Following are the online tools available freely for primer designing:
Primer blast (https://www.ncbi.nlm.nih.gov/tools/primer-blast/)
Primer3 (http://primer3.ut.ee/)
Primer3plus (https://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi/